| Detail of Probeset Mtr.40083.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.40083.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC106462 /FEA=mRNA /DEF=UP|H1L1_OSTED (Q86QH9) Sperm-specific H1/protamine-like protein type 1 precursor [Contains: Sperm-specific protein OE1 (Sperm-specific linker histone H1-like protein OE1); Sperm-specific protein OE3 (Protamine-like OS3)], partial ( |
| Mapped public sequence ID | TC106462 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT41219 AW980514 AW980837 |
| Target sequence | attatctttctatccctattggtggttgcaatgaatgctaaacgaaattatcaatgtgat |