| Detail of Probeset Mtr.40144.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.40144.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC106608 /FEA=mRNA /DEF=similar to UP|Q75QC2 (Q75QC2) Glutamate-rich protein, partial (27%) |
| Mapped public sequence ID | TC106608 |
| Gene Ontology | GO:0004565 GO:0005515 GO:0005990 |
| KEGG | K01190 K11450 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40429 TCMS40430 TCMT42094 BQ153413 BQ157787 BQ145487 |
| Target sequence | taatggttctagttgttgggatcgggtctaccattttgcatgtcgaggttgaaaagtttt |