| Detail of Probeset Mtr.40163.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.40163.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC106653 /FEA=mRNA /DEF=weakly similar to UP|PRP1_SOYBN (P08012) Repetitive proline-rich cell wall protein 1 precursor, partial (16%) |
| Mapped public sequence ID | TC106653 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT42069 BQ150550 TCMT41570 BQ143768 BQ158546 |
| Target sequence | actaatatggcttcctttcgcttcctagtgttgcttcttattgttctcattgtcatccct |