Detail of Probeset Mtr.40234.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.40234.1.S1_at
Species Medicago truncatula
Annotation TC106816 /FEA=mRNA /DEF=homologue to UP|Q6SZ89 (Q6SZ89) Translational elongation factor 1 subunit Bbeta, partial (96%)
Mapped public sequence ID TC106816
Gene Ontology GO:0003746 GO:0003747 GO:0005085 GO:0005811 GO:0005829 GO:0005853 GO:0006414
KEGG K03232
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence gggtgcattttattactatcacagccaaacttgttcctg