| Detail of Probeset Mtr.40289.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.40289.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC106963 /FEA=mRNA /DEF=homologue to UP|Q41668 (Q41668) Guanine nucleotide regulatory protein, complete |
| Mapped public sequence ID |
TC106963 |
| Gene Ontology |
GO:0001702 GO:0002119 GO:0005515 GO:0005768 GO:0006898 GO:0007028 GO:0008105 GO:0008219 GO:0009306 GO:0009792 GO:0016337 GO:0018996 GO:0030100 GO:0040007 |
| KEGG |
K07976 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
cgtgttgttcataagtgtttcagctgtatttaccggcctttctctttttaatttgtattg
ttttcagtggtttgtatgtgctgcaccgaacttgggttatcactgttatatggagctcca
acagtatatgaatgcaatttgccacacagaacttgttggttcaaaaatatcccttggatg
catatttgggtccttgctacaaatctatagtctaaaatatctcctggttat |
