| Detail of Probeset Mtr.40343.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.40343.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
TC107089 /FEA=mRNA /DEF=similar to UP|Q8L6F0 (Q8L6F0) Dihydrofolate reductase-thymidylate synthase , partial (12%) |
| Mapped public sequence ID |
TC107089 |
| Gene Ontology |
GO:0000166 GO:0004799 GO:0005829 GO:0006231 GO:0042083 GO:0046078 GO:0048037 GO:0060041 GO:0004146 GO:0006760 GO:0008144 GO:0016072 GO:0042254 GO:0009792 GO:0010171 |
| KEGG |
K00287 K00560 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT46502 TCMT46500
TCMT46501 CX526662
|
| Target sequence |
attgcactgcacttccaaaagaattggttgtgcagtccttattttcatccgaaccaatct
ttaagtctgtgtcgtcggtttcttagttctactatggctggtgattc |