| Detail of Probeset Mtr.40343.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.40343.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | TC107089 /FEA=mRNA /DEF=similar to UP|Q8L6F0 (Q8L6F0) Dihydrofolate reductase-thymidylate synthase , partial (12%) |
| Mapped public sequence ID | TC107089 |
| Gene Ontology | GO:0000166 GO:0004799 GO:0005829 GO:0006231 GO:0042083 GO:0046078 GO:0048037 GO:0060041 GO:0004146 GO:0006760 GO:0008144 GO:0016072 GO:0042254 GO:0009792 GO:0010171 |
| KEGG | K00287 K00560 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT46502 TCMT46500 TCMT46501 CX526662 |
| Target sequence | attgcactgcacttccaaaagaattggttgtgcagtccttattttcatccgaaccaatct |