Detail of Probeset Mtr.40365.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.40365.1.S1_at
Species Medicago truncatula
Annotation TC107134 /FEA=mRNA /DEF=homologue to UP|KADB_ORYSA (Q08480) Adenylate kinase B (ATP-AMP transphosphorylase) , partial (84%)
Mapped public sequence ID TC107134
Gene Ontology GO:0004017 GO:0005524 GO:0005737 GO:0005739 GO:0005758 GO:0005811 GO:0006166 GO:0006172
KEGG K00939
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT43250  
Target sequence gtccaagcacagaaggtattgccttgtttgccatctgaactactgacttgatgagatgct
g