Detail of Probeset Mtr.40365.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.40365.1.S1_at |
Species |
Medicago truncatula |
Annotation |
TC107134 /FEA=mRNA /DEF=homologue to UP|KADB_ORYSA (Q08480) Adenylate kinase B (ATP-AMP transphosphorylase) , partial (84%) |
Mapped public sequence ID |
TC107134 |
Gene Ontology |
GO:0004017 GO:0005524 GO:0005737 GO:0005739 GO:0005758 GO:0005811 GO:0006166 GO:0006172 |
KEGG |
K00939 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT43250 |
Target sequence |
gtccaagcacagaaggtattgccttgtttgccatctgaactactgacttgatgagatgct
g |