| Detail of Probeset Mtr.40645.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.40645.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | TC107740 /FEA=mRNA /DEF=similar to UP|Q9FI52 (Q9FI52) Nucleotide-binding protein, partial (60%) |
| Mapped public sequence ID | TC107740 |
| Gene Ontology | GO:0005524 GO:0005575 GO:0008150 |
| KEGG | K03593 K24826 |
| Transporter | 3.A.4 3.A.4.1.1 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | EL610017 TCMT55937 TCMT55938 |
| Target sequence | gaaagaatggccactgtgaaacataagatactggtcttgtcaggaaagggaggtgttggc |