| Detail of Probeset Mtr.40893.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.40893.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC108274 /FEA=mRNA /DEF=similar to UP|Q9LF41 (Q9LF41) Ubiquitin-fusion degradation protein-like, partial (9%) |
| Mapped public sequence ID |
TC108274 |
| Gene Ontology |
GO:0000209 GO:0004842 GO:0005515 GO:0005634 GO:0005737 GO:0006915 GO:0009411 GO:0019899 GO:0034450 |
| KEGG |
K10597 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT51635 |
| Target sequence |
gtattgtaggattcatcttgcgaatcccgagctttttagtggagctcgggattcaaattt
cag |
