Detail of Probeset Mtr.40893.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.40893.1.S1_at
Species Medicago truncatula
Annotation TC108274 /FEA=mRNA /DEF=similar to UP|Q9LF41 (Q9LF41) Ubiquitin-fusion degradation protein-like, partial (9%)
Mapped public sequence ID TC108274
Gene Ontology GO:0000209 GO:0004842 GO:0005515 GO:0005634 GO:0005737 GO:0006915 GO:0009411 GO:0019899 GO:0034450
KEGG K10597
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT51635  
Target sequence gtattgtaggattcatcttgcgaatcccgagctttttagtggagctcgggattcaaattt
cag