| Detail of Probeset Mtr.40918.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.40918.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC108327 /FEA=mRNA /DEF=UP|Q8SAE5 (Q8SAE5) Ankyrin-kinase, complete |
| Mapped public sequence ID | TC108327 |
| Gene Ontology | GO:0004672 GO:0005524 GO:0005575 GO:0006468 GO:0007242 GO:0051219 |
| KEGG | K04366 K04418 K04424 K04427 K06272 K08845 |
| Transporter | 1.A.1 1.A.1.4.4 1.A.1.4.5 |
| Transcription Factor | WRKY |
| Mapped unigene in the TRICHOME database | AF458700 TCMT56384 DY615441 |
| Target sequence | taagacggccatcagagcaagcagtagatatcgatcagagttgtatcatcaaaactgatt |