| Detail of Probeset Mtr.41273.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.41273.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC109053 /FEA=mRNA /DEF=similar to UP|Q5VRW6 (Q5VRW6) Band 3 anion transport protein-like, partial (37%) |
| Mapped public sequence ID |
TC109053 |
| Gene Ontology |
GO:0005452 GO:0006820 GO:0006885 GO:0015380 GO:0016021 GO:0000324 GO:0005624 GO:0005773 GO:0005886 GO:0006623 GO:0006810 GO:0008509 GO:0018193 GO:0046713 GO:0046714 GO:0046715 GO:0005515 GO:0030218 GO:0035162 |
| KEGG |
K06573 |
| Transporter |
2.A.31 2.A.31.1.1 2.A.31.3.1 2.A.31.3.2 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT53677 |
| Target sequence |
ggatattgcttctttttgtaagacctagtagatggtacaagttgttggaaagtgatcatg
cttcctttgttgagtcagtaccattcaaacatatagtattggttacactcttccaatgtg
tgtatttcttggtttgttttggagtgacatggattccaattgctggaatgttgttcccct
ttgccattctttttgctgatc |
