| Detail of Probeset Mtr.41504.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.41504.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC109530 /FEA=mRNA /DEF=similar to UP|Q76CU2 (Q76CU2) PDR-type ABC transporter 1, partial (27%) |
| Mapped public sequence ID |
TC109530 |
| Gene Ontology |
GO:0005524 GO:0005768 GO:0006810 GO:0006887 GO:0006897 GO:0016020 GO:0016021 GO:0030154 GO:0042626 GO:0048388 |
| KEGG |
K01552 K03297 K08711 |
| Transporter |
3.A.1 3.A.1.205 3.A.1.205.6 3.A.1.205.7 3.A.1.205.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT57844 |
| Target sequence |
cttttggaaacaatgcatggcttgcttatggaaacaacattggtcttattggcgcaatcc
tgaatataatgccattagatttctgtactcaaccgcagttgctgttttgtttggaagcat
gttttgggaccttggctccaaaattgaaaaggaacaagatctttttaatgccatggggtc
catgtattctgctgtgatcgtaattggcatcaagaatgctaattcagtgcagc |