| Detail of Probeset Mtr.42141.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.42141.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | TC110836 /FEA=mRNA /DEF=similar to UP|Q7XYR7 (Q7XYR7) Class III peroxidase, partial (48%) |
| Mapped public sequence ID | TC110836 |
| Gene Ontology | GO:0004601 GO:0020037 GO:0009533 GO:0009535 GO:0016688 |
| KEGG | K00430 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40288 TCMT56925 BG454205 |
| Target sequence | caagctttaccggtgagaagaatgcaaatccaaatagaaactccgctcgtggatttgatg |