| Detail of Probeset Mtr.42210.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.42210.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC110964 /FEA=mRNA /DEF=weakly similar to UP|PRR3_ARATH (Q9LVG4) Two-component response regulator-like APRR3 (Pseudo-response regulator 3), partial (18%) |
| Mapped public sequence ID |
TC110964 |
| Gene Ontology |
GO:0000155 GO:0000156 GO:0000160 GO:0004115 GO:0005622 GO:0006198 GO:0006970 GO:0007275 GO:0030435 GO:0030587 GO:0031276 GO:0046058 GO:0047555 GO:0051279 GO:0051281 |
| KEGG |
K05971 K08282 K08857 |
| Transporter |
|
| Transcription Factor |
C2C2-CO-like |
| Mapped unigene in the TRICHOME database |
TCMT57718 |
| Target sequence |
gctcatgatacggagaatccacaattcacntcaacaaggggattgggtttgtgcattcct
gataactcctcacctagttgttttttgagtgtggttgataataatttaggctgatacaat
gaacaat |
