Detail of Probeset Mtr.42700.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.42700.1.S1_at
Species Medicago truncatula
Annotation TC112194 /FEA=mRNA /DEF=similar to UP|PUR5_VIGUN (P52424) Phosphoribosylformylglycinamidine cyclo-ligase, chloroplast precursor (AIRS) (Phosphoribosyl-aminoimidazole synthetase) (AIR synthase) , partial (7%)
Mapped public sequence ID TC112194
Gene Ontology GO:0004637 GO:0004641 GO:0005737 GO:0006144 GO:0006164 GO:0006189 GO:0009152
KEGG K01933
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT57489  
Target sequence gcagcaccatccgtctttccaatcaccgccgcctccatccctccccacctaacctaagtt
tctctcttcatatacttattctacctctcttagcaatgagtttcggagct