| Detail of Probeset Mtr.4278.1.S1_x_at in Chip AffyMedicago | |
| Probeset ID | Mtr.4278.1.S1_x_at |
| Species | Medicago truncatula |
| Annotation | AA660418 /FEA=mRNA /DEF=similar to UP|TCTP_MEDSA (P28014) Translationally controlled tumor protein homolog (TCTP), partial (49%) |
| Mapped public sequence ID | AA660418 |
| Gene Ontology | GO:0003674 GO:0005634 GO:0005737 GO:0005739 GO:0005829 GO:0005840 GO:0006412 GO:0006979 GO:0005509 GO:0005515 GO:0005615 GO:0005771 GO:0006916 GO:0007283 GO:0008283 GO:0045298 |
| KEGG | K14006 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40709 AL368280 TCMT40364 AA660418 BF519031 |
| Target sequence | tcgctccgtacccttgttgtttcaccgcacgaactcactttg |