| Detail of Probeset Mtr.42852.1.S1_x_at in Chip AffyMedicago | |
| Probeset ID | Mtr.42852.1.S1_x_at |
| Species | Medicago truncatula |
| Annotation | TC93949 /FEA=mRNA /DEF=homologue to UP|H1L1_OSTED (Q86QH9) Sperm-specific H1/protamine-like protein type 1 precursor [Contains: Sperm-specific protein OE1 (Sperm-specific linker histone H1-like protein OE1); Sperm-specific protein OE3 (Protamine-like OS3) |
| Mapped public sequence ID | TC93949 |
| Gene Ontology | GO:0004565 GO:0005515 GO:0005990 |
| KEGG | K01190 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | CX540848 TCMT41944 BQ145905 TCMT41865 CX541276 TCMT41735 |
| Target sequence | ggagaagtcatcacagtagcttgctattggacttcttatgtgtcgctcatgtgttgcac |