Detail of Probeset Mtr.42889.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.42889.1.S1_at
Species Medicago truncatula
Annotation TC94036 /FEA=mRNA /DEF=homologue to UP|Q9ASR1 (Q9ASR1) At1g56070/T6H22_13 (Elongation factor EF-2), partial (22%)
Mapped public sequence ID TC94036
Gene Ontology GO:0003746 GO:0005525 GO:0005737 GO:0005829 GO:0005840 GO:0006414 GO:0016462 GO:0016817 GO:0016818
KEGG K03234
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT42333  
Target sequence aacaacactctttttgcgtgtggattatttcaaagactagtcacaatggtgaagtttac