| Detail of Probeset Mtr.42901.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.42901.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
TC94073 /FEA=mRNA /DEF=homologue to UP|H1L1_OSTED (Q86QH9) Sperm-specific H1/protamine-like protein type 1 precursor [Contains: Sperm-specific protein OE1 (Sperm-specific linker histone H1-like protein OE1); Sperm-specific protein OE3 (Protamine-like OS3) |
| Mapped public sequence ID |
TC94073 |
| Gene Ontology |
GO:0004565 GO:0005515 GO:0005990 |
| KEGG |
K01190 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT41775 BQ145214
|
| Target sequence |
gcaccttttcaaaatacccgtgtcaatttcttcctatccacttttttttttatagttttt
atttacttttatttttagtttattagtaatgttatgggatttattttttagcatgattct
atcaacttgatagagaattctcagaaa |
