| Detail of Probeset Mtr.42933.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.42933.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | TC94143 /FEA=mRNA /DEF=similar to UP|NLTP_CICAR (O23758) Nonspecific lipid-transfer protein precursor (LTP), complete |
| Mapped public sequence ID | TC94143 |
| Gene Ontology | GO:0005215 GO:0005575 GO:0006869 GO:0008289 GO:0050830 GO:0050832 |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT42070 TCMT41148 TCMT41164 BQ151559 TCMT41624 |
| Target sequence | agatgctgcaatctcatgtggaacagtaactagtgctcttggtccatgcattggatatct |