| Detail of Probeset Mtr.43098.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.43098.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC94532 /FEA=mRNA /DEF=similar to UP|Q9SBS0 (Q9SBS0) O-diphenol-O-methyl transferase , complete |
| Mapped public sequence ID | TC94532 |
| Gene Ontology | GO:0005575 GO:0008150 GO:0008168 GO:0008171 GO:0019438 |
| KEGG | K00599 K05279 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40540 TCMT42136 TCMT40803 |
| Target sequence | atatgatctcttctgcacctcaatatccaggtataacacacgtcggtggtgatgcgcttg |