| Detail of Probeset Mtr.43102.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.43102.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC94538 /FEA=mRNA /DEF=similar to UP|O48618 (O48618) Cytochome b5 (Fragment), complete |
| Mapped public sequence ID | TC94538 |
| Gene Ontology | GO:0005741 GO:0005743 GO:0005792 GO:0008047 GO:0045153 GO:0005575 GO:0005811 GO:0009055 GO:0016020 |
| KEGG | K00326 K10686 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40751 TCMT42808 BQ145669 BQ137809 |
| Target sequence | gtgagattgatccatccactgttcccctaaagcgcacctatgttccacctcagcagtctc |