| Detail of Probeset Mtr.43582.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.43582.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC95646 /FEA=mRNA /DEF=similar to UP|Q8W040 (Q8W040) Dihydrofolate synthetase /folylpolyglutamate synthetase, partial (41%) |
| Mapped public sequence ID |
TC95646 |
| Gene Ontology |
GO:0004326 GO:0005524 GO:0005575 GO:0005737 GO:0005739 GO:0009396 GO:0046901 |
| KEGG |
K01930 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gaatcttaaagcatcgaattccaacatttacagttactc |