Detail of Probeset Mtr.44192.1.S1_a_at in Chip AffyMedicago
Probeset ID Mtr.44192.1.S1_a_at
Species Medicago truncatula
Annotation TC96879 /FEA=mRNA /DEF=similar to UP|Q7XAC3 (Q7XAC3) Peptide transporter 1, partial (25%)
Mapped public sequence ID TC96879
Gene Ontology GO:0005290 GO:0005427 GO:0005765 GO:0015817 GO:0030163
KEGG K03305
Transporter 2.A.17 2.A.17.3.1 2.A.17.3.2
Transcription Factor
Mapped unigene in the TRICHOME database TCMT49288  
Target sequence ttcagctggacttggcttaggatttttcagctggacttggcttaggatttttcagctgga
ct