Detail of Probeset Mtr.44343.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.44343.1.S1_at |
Species |
Medicago truncatula |
Annotation |
TC97179 /FEA=mRNA /DEF=similar to UP|Q681Y3 (Q681Y3) MRNA, complete cds, clone: RAFL21-91-J21, partial (47%) |
Mapped public sequence ID |
TC97179 |
Gene Ontology |
GO:0003674 GO:0004047 GO:0005575 GO:0008150 GO:0019464 |
KEGG |
K00605 K06980 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT60256 |
Target sequence |
aggatgtgacactgtttttgtaacaccaacagctcgaactatagatattgcacatgcatg
gatcatgaaaaat |