| Detail of Probeset Mtr.44626.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.44626.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC97746 /FEA=mRNA /DEF=weakly similar to UP|Q84QE1 (Q84QE1) Avr9/Cf-9 rapidly elicited protein 189, partial (21%) |
| Mapped public sequence ID |
TC97746 |
| Gene Ontology |
GO:0000151 GO:0004842 GO:0005515 GO:0006511 |
| KEGG |
K10286 K21630 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT60189 |
| Target sequence |
caatcttaaccgttcatttcaccgatagttcaatatcaaccgtggatgggccaagcagct
|