Detail of Probeset Mtr.45070.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.45070.1.S1_at
Species Medicago truncatula
Annotation TC98714 /FEA=mRNA /DEF=weakly similar to UP|Q75WU3 (Q75WU3) Leucine-rich repeat receptor-like protein kinase 1, partial (7%)
Mapped public sequence ID TC98714
Gene Ontology GO:0005524 GO:0005576 GO:0005737 GO:0005886 GO:0006468 GO:0007163 GO:0016337 GO:0019199 GO:0030833 GO:0031152 GO:0031154 GO:0031589 GO:0043326 GO:0043327 GO:0045335
KEGG K00924
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT48430  
Target sequence aaaaaatccagctagcttcttgaataatggcagtatccacgtttcattatgatcatgttc
at