| Detail of Probeset Mtr.45508.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.45508.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | TC99805 /FEA=mRNA /DEF=similar to UP|C48B_ARATH (Q9ZPR1) Cell division control protein 48 homolog B (AtCDC48b), partial (12%) |
| Mapped public sequence ID | TC99805 |
| Gene Ontology | GO:0005515 GO:0005634 GO:0005783 GO:0005792 GO:0005829 GO:0006302 GO:0006888 GO:0006919 GO:0006974 GO:0016887 GO:0019904 GO:0030970 GO:0043161 GO:0051260 GO:0000790 GO:0005737 GO:0006510 GO:0006511 GO:0006906 GO:0007059 GO:0007346 GO:0030433 GO:0033554 GO:0051230 |
| KEGG | K01509 K01529 K06027 K21952 |
| Transporter | 3.A.16.1.1 3.A.16.1.2 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | BE326145 TCMT53494 BI266604 |
| Target sequence | agcaccaacggtcaccataaagcagaggatgtcgtcggtggcaacgctaaagctattcaa |