| Detail of Probeset Mtr.45563.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.45563.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC99930 /FEA=mRNA /DEF=weakly similar to UP|Q9LFH0 (Q9LFH0) PDR9 ABC transporter, partial (10%) |
| Mapped public sequence ID |
TC99930 |
| Gene Ontology |
GO:0005524 GO:0005768 GO:0006810 GO:0006887 GO:0006897 GO:0016020 GO:0016021 GO:0030154 GO:0042626 GO:0048388 |
| KEGG |
K01552 K03297 K08711 |
| Transporter |
3.A.1 3.A.1.205 3.A.1.205.1 3.A.1.205.7 3.A.1.205.4 3.A.1.205.6 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT58585 |
| Target sequence |
gaaaatggtcctgccctttttgccactgtcaatagcatttaaagatgttcagtattttgt
cgacactcctccggagatgaaaaagcacggttcgaatgagaaactacaactgctctgcga
tatcactggagcttttaagccaggaatcctcactgcattgatgggagtcagtggagcagg
gaagacaacactcatggatgtcctttcgggaa |