| Detail of Probeset Mtr.45612.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.45612.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
GAP|psbH /FEA=mRNA /DEF=from 51612 to 51824 (on reverse strand) |
| Mapped public sequence ID |
GAP|psbH |
| Gene Ontology |
GO:0030096 GO:0009512 GO:0009775 GO:0045158 |
| KEGG |
K02635 K02709 |
| Transporter |
3.D.3 3.E.2 3.D.3.4.1 3.E.2.2.2 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMS40987 TCMS40986
TCMT42341 TCMT42719
BQ157925 BF638037
BF638198 |
| Target sequence |
tgatgggtattgcaatggctctatttgcggtatttctctctattattttagagatttata
attcgtccattttactggaccaaat |