| Detail of Probeset Mtr.45654.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.45654.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|723.m00021 /FEA=mRNA /DEF=hypothetical protein AC119417.17.211 70464 70140 mth1-6m23 01/13/05 |
| Mapped public sequence ID | IMGAG|723.m00021 |
| Gene Ontology | GO:0000723 GO:0000724 GO:0000781 GO:0003697 GO:0005634 GO:0005662 GO:0005737 GO:0005829 GO:0006261 GO:0006269 GO:0006281 |
| KEGG | K03469 K07466 K11360 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | EX529394 |
| Target sequence | gcgtctttatcagatgacttgctcaacactaa |