Detail of Probeset Mtr.45698.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.45698.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|1007.m00014 /FEA=mRNA /DEF=conserved hypothetical protein AC141865.25.141 48967 48410 mth2-7b19 01/13/05 |
Mapped public sequence ID |
IMGAG|1007.m00014 |
Gene Ontology |
GO:0000002 GO:0000085 GO:0000287 GO:0000723 GO:0000784 GO:0005524 GO:0005634 GO:0005730 GO:0005739 GO:0006261 GO:0006281 GO:0006310 GO:0017116 GO:0032204 GO:0033567 GO:0033682 GO:0042162 GO:0043137 GO:0043141 GO:0051974 |
KEGG |
K01529 K23961 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
tacccattgccatctctagatgtccagttatgc |