| Detail of Probeset Mtr.45729.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.45729.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1122.m00018 /FEA=mRNA /DEF=ATP sulfurylase-related AC146721.7.181 116997 115656 mth2-145n10 01/13/05 |
| Mapped public sequence ID |
IMGAG|1122.m00018 |
| Gene Ontology |
GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0005739 GO:0008233 GO:0032197 |
| KEGG |
K00140 K15001 K22300 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atggcatctccgatcgtgtcacgattgccaaatcgcgacacgattcctctgtttttccaa
accacaaatttgaagccaattttcaacaaacgggacttgtatgaccc |
