| Detail of Probeset Mtr.45839.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.45839.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1126.m00012 /FEA=mRNA /DEF=Zn-finger, Tim10/DDP type AC146747.7.121 56623 54256 mth2-14h5 01/13/05 |
| Mapped public sequence ID |
IMGAG|1126.m00012 |
| Gene Ontology |
GO:0005744 GO:0005758 GO:0005829 GO:0006626 GO:0008565 GO:0015031 GO:0015450 GO:0042719 GO:0045039 GO:0005515 GO:0007605 GO:0008270 |
| KEGG |
K10836 K21494 K21816 K25334 |
| Transporter |
3.A.8 3.A.8.1.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT59693 |
| Target sequence |
atggatctttccgacctcaattctgctgaaatgcagaggttttactctgaagaacaacaa
agagccatgattaatgaaatggtggcaaagatgactagtcaatgctgggacaaatgcatc
acaggcacgccggggaataagttcagttccggtgagactaattgcctaacacactgtgca
cagcgttacgtggagatgagcatgcttatcatgaaacggtttcagagtatgcaatga |
