| Detail of Probeset Mtr.45881.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.45881.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1010.m00009 /FEA=mRNA /DEF=probable indole-3-acetate beta-glucosyltransferase T27E13.11 - Arabidopsis thaliana AC141923.27.81 51032 48484 mth2-7f19 01/13/05 |
| Mapped public sequence ID |
IMGAG|1010.m00009 |
| Gene Ontology |
GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0005739 GO:0008233 GO:0032197 |
| KEGG |
K08236 K08237 K15001 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
agctactacattgagtggctagattcacaacctattggttctgttctttatattgcacaa
ggaagttttttctcggtttcaagtgcacaaattgatgagattgcagctgctttgtgtgca
agcaatgttcggttcttatggatagcacgtagtgaggcttcaaggttgaaggaaatttgt
ggtgctcatca |
