Detail of Probeset Mtr.45978.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.45978.1.S1_at
Species Medicago truncatula
Annotation IMGAG|1011.m00025 /FEA=mRNA /DEF=hypothetical protein AC142143.28.241 102026 102175 mth2-25c22 01/13/05
Mapped public sequence ID IMGAG|1011.m00025
Gene Ontology GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197
KEGG K07497
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence gatgtccacccctaatcatcattgtgtggcgggatgcggcgaggtcgaaacagcccaaaa
tctgttaa