| Detail of Probeset Mtr.46008.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.46008.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1135.m00002 /FEA=mRNA /DEF=Ubiquitin-conjugating enzymes; Tumour susceptibility gene 101 AC146777.27.11 5919 7154 mth2-173c10 01/13/05 |
| Mapped public sequence ID |
IMGAG|1135.m00002 |
| Gene Ontology |
GO:0003677 GO:0003714 GO:0005515 GO:0005575 GO:0005730 GO:0005771 GO:0005886 GO:0043130 GO:0043162 GO:0046755 |
| KEGG |
K01931 K16611 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
cttctcggcctacgcatacggaggatcctaccgaggtttttaggaggaatgctattaaca
agctggtggagatggtgcataatgatgtaacggcgttgaggaagaccagagaa |