| Detail of Probeset Mtr.46170.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.46170.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1239.m00001 /FEA=mRNA /DEF=conserved hypothetical protein protein AC149130.2.1 13 333 mth2-193n2 01/13/05 |
| Mapped public sequence ID | IMGAG|1239.m00001 |
| Gene Ontology | GO:0003899 GO:0005634 GO:0005730 GO:0005736 GO:0006360 GO:0005515 GO:0009303 |
| KEGG | K03005 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | EY475485 TCMT59124 TCMT59125 |
| Target sequence | aagtaaaagaaactgctcttgcaaatacagaagctcacgttactcgccatataccaccat |