| Detail of Probeset Mtr.46283.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.46283.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1143.m00012 /FEA=mRNA /DEF=2OG-Fe(II) oxygenase AC146817.10.121 51633 47813 mth2-8c19 01/13/05 |
| Mapped public sequence ID |
IMGAG|1143.m00012 |
| Gene Ontology |
GO:0005506 GO:0005575 GO:0009693 GO:0009815 GO:0008152 GO:0016491 |
| KEGG |
K05278 K05933 K06892 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT45064 |
| Target sequence |
caagacttgccactagtatgcagggatgaacttttggaatatggtgaatatgtaacgaaa
cttggaatgacactct |