Detail of Probeset Mtr.46360.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.46360.1.S1_at
Species Medicago truncatula
Annotation IMGAG|1244.m00026 /FEA=mRNA /DEF=LQGC hypothetical protein AC149208.4.261 85035 84772 mth2-156l8 01/13/05
Mapped public sequence ID IMGAG|1244.m00026
Gene Ontology GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197
KEGG K07497
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence tttagttggacctcgagtgcctttgagtgcctga