Detail of Probeset Mtr.46680.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.46680.1.S1_s_at
Species Medicago truncatula
Annotation 1741.m00042 /FEA=mRNA /DEF=AC151525.10 39466 39182 mth2-77j8
Mapped public sequence ID 1741.m00042
Gene Ontology GO:0000118 GO:0000792 GO:0003677 GO:0003682 GO:0003700 GO:0003714 GO:0004407 GO:0005515 GO:0005634 GO:0005737 GO:0007492 GO:0008134 GO:0016481 GO:0016568 GO:0016581 GO:0019899 GO:0042802 GO:0001764 GO:0008285 GO:0016055 GO:0016575 GO:0021754 GO:0030318 GO:0031017 GO:0048709 GO:0050769 GO:0060028
KEGG K06067
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence gaagagactcttacatacattttacagcagccgagagagagagagagagagagagagaga
agctgcaaggatctaggtctctttcctttcaggt