| Detail of Probeset Mtr.4670.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.4670.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | AL374483 /FEA=mRNA /DEF=similar to UP|RL18_CICAR (O65729) 60S ribosomal protein L18 (Fragment), partial (42%) |
| Mapped public sequence ID | AL374483 |
| Gene Ontology | GO:0003674 GO:0003723 GO:0003735 GO:0005575 GO:0005829 GO:0006414 GO:0008150 GO:0022625 |
| KEGG | K02883 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT42482 BQ137648 AL374483 |
| Target sequence | ggtgtgccacacagcaacactaagccctatgtccgtgggaaaaaatcacgaaaggttgaa |