| Detail of Probeset Mtr.46721.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.46721.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
1737.m00057 /FEA=mRNA /DEF=AC150845.5 76451 73061 mth2-150a2 weakly similar to TIGR_Ath1|At3g14690-GOpep .1 68410.m01668 cytochrome P450, putative similar to GB:Q05047 from [Catharanthus, complete |
| Mapped public sequence ID |
1737.m00057 |
| Gene Ontology |
GO:0001822 GO:0005504 GO:0005792 GO:0008391 GO:0008393 GO:0008405 GO:0009725 GO:0019369 GO:0042493 GO:0043651 GO:0046456 GO:0048252 GO:0050544 GO:0009055 GO:0009792 GO:0016020 |
| KEGG |
K00517 K07425 K10717 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ctttaatttacttcaaccgagctcttcgaaaggatttgaaacttggaaacgtttcgctac
ctgaaggaacacaaatttccctaccaatactattgattc |
