Detail of Probeset Mtr.4682.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.4682.1.S1_s_at
Species Medicago truncatula
Annotation AL375366 /FEA=mRNA /DEF=homologue to PIR|T07634|T07634 pollen-specific protein homolog T1P17.10 - Arabidopsis thaliana {Arabidopsis thaliana;} , partial (12%)
Mapped public sequence ID AL375366
Gene Ontology GO:0001516 GO:0004322 GO:0005515 GO:0005783 GO:0005886 GO:0006827 GO:0015684 GO:0033215 GO:0042493 GO:0055085
KEGG K00368 K00423
Transporter 9.A.10 9.A.10.1.1
Transcription Factor
Mapped unigene in the TRICHOME database TCMT46536  
Target sequence gcaatcacacggctttgagaaaggctctagatgatggaaaagatcttggcatgccagatg
gtgttctcatcaatgggaaaggcgccttatagatacaatgatacacttgttcctgagggc
at