Detail of Probeset Mtr.4682.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.4682.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
AL375366 /FEA=mRNA /DEF=homologue to PIR|T07634|T07634 pollen-specific protein homolog T1P17.10 - Arabidopsis thaliana {Arabidopsis thaliana;} , partial (12%) |
Mapped public sequence ID |
AL375366 |
Gene Ontology |
GO:0001516 GO:0004322 GO:0005515 GO:0005783 GO:0005886 GO:0006827 GO:0015684 GO:0033215 GO:0042493 GO:0055085 |
KEGG |
K00368 K00423 |
Transporter |
9.A.10 9.A.10.1.1 |
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT46536 |
Target sequence |
gcaatcacacggctttgagaaaggctctagatgatggaaaagatcttggcatgccagatg
gtgttctcatcaatgggaaaggcgccttatagatacaatgatacacttgttcctgagggc
at |