| Detail of Probeset Mtr.46922.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.46922.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1715.m00033 /FEA=mRNA /DEF=AC149474.11 64228 58461 mth2-122l24 weakly similar to TIGR_Ath1|At1g56345-GOpep .1 68408.m05936 RNA pseudouridylate synthase -related contains Pfam profile:, partial (86%) |
| Mapped public sequence ID | 1715.m00033 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | tttggcttttgctgtggaggaacacgttgatct |