| Detail of Probeset Mtr.47074.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.47074.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1700.m00065 /FEA=mRNA /DEF=AC147959.8 114664 116482 mth2-11c16 weakly similar to TIGR_Ath1|At5g04070-GOpep .1 68412.m00363 short-chain dehydrogenase/reductase family protein contains, partial (49%) |
| Mapped public sequence ID |
1700.m00065 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ttggcgggtttttggctttctgccatgtggccaattttgtgaaggatggtgactccatga
catcatccatcggacatagtggcgctatatgtcagccggatttattacggtc |
