Detail of Probeset Mtr.47305.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.47305.1.S1_s_at
Species Medicago truncatula
Annotation 1680.m00064 /FEA=mRNA /DEF=AC146744.24 96497 97791 mth2-176p12
Mapped public sequence ID 1680.m00064
Gene Ontology GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0000739 GO:0003677 GO:0003845 GO:0005496 GO:0005507 GO:0005524 GO:0005634 GO:0005730 GO:0005737 GO:0005739 GO:0005789 GO:0005791 GO:0005792 GO:0006289 GO:0006694 GO:0006704 GO:0006713 GO:0006915 GO:0007275 GO:0007569 GO:0008152 GO:0008635 GO:0016491 GO:0030308 GO:0030324 GO:0031965 GO:0043456 GO:0045177 GO:0050661
KEGG K07497 K23458
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence agcgatgaatctaggctcggacatgatgcactttctacacgaa