Detail of Probeset Mtr.47320.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.47320.1.S1_at |
Species |
Medicago truncatula |
Annotation |
1679.m00058 /FEA=mRNA /DEF=AC146719.19 41919 42290 mth2-17f11 weakly similar to UP|P93705 (P93705) Carrot hypocotil specific |
Mapped public sequence ID |
1679.m00058 |
Gene Ontology |
GO:0003674 GO:0003677 GO:0003700 GO:0005575 GO:0005634 GO:0006355 GO:0008150 GO:0043565 GO:0008270 |
KEGG |
K02519 K10515 K19503 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
aggaatgatccctcctacgagaggaacaattggag |