Detail of Probeset Mtr.47320.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.47320.1.S1_at
Species Medicago truncatula
Annotation 1679.m00058 /FEA=mRNA /DEF=AC146719.19 41919 42290 mth2-17f11 weakly similar to UP|P93705 (P93705) Carrot hypocotil specific
Mapped public sequence ID 1679.m00058
Gene Ontology GO:0003674 GO:0003677 GO:0003700 GO:0005575 GO:0005634 GO:0006355 GO:0008150 GO:0043565 GO:0008270
KEGG K02519 K10515 K19503
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence aggaatgatccctcctacgagaggaacaattggag