| Detail of Probeset Mtr.47388.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.47388.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1672.m00032 /FEA=mRNA /DEF=AC146333.27 5047 6121 mth2-8d3 |
| Mapped public sequence ID | 1672.m00032 |
| Gene Ontology | GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0005739 GO:0008233 GO:0032197 |
| KEGG | K00140 K13663 K15001 K17671 K17699 K22300 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | tctataaatagagggcttggccttagcaaaacacgaaccattgcaaagcat |