| Detail of Probeset Mtr.47490.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.47490.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
1660.m00069 /FEA=mRNA /DEF=AC145061.22 119762 116573 mth2-6a18 weakly similar to UP|C7D9_SOYBN (O81971) Cytochrome P450 71D9 (EC 1.14.-.-) (P450 CP3) |
| Mapped public sequence ID |
1660.m00069 |
| Gene Ontology |
GO:0004508 GO:0005739 GO:0005783 GO:0005789 GO:0006694 GO:0006702 GO:0006704 GO:0007548 GO:0009636 GO:0019825 GO:0030424 GO:0043025 |
| KEGG |
K00517 K07414 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ttttattgccaagggagtgtggacaagcatgtgaaataaatgggtatggtataccattta
aaagcaaagtgatagtgaatgcttgggccattggaagagatccaaataattgggatgatc
cagaaagattttatcctgaaaggttcatcgacaattgtgtagattattacaaaggtaata
attttgagttcattccgtttggcagtggc |